sequence based reagents qpcr primers  (Thermo Fisher)

Journal: eLife

Article Title: Growth cone advance requires EB1 as revealed by genomic replacement with a light-sensitive variant

doi: 10.7554/elife.84143

Figure Lengend Snippet: Figure 1. One-step genome editing to replace EB1 with a photo-sensitive variant. (A) AlphaFold2 model of the π-EB1 tetramer (Mirdita et al., 2022). Note that AlphaFold2 does not correctly predict relative domain positions and did not capture the LOV2/Zdk1 interaction correctly although a structure of the LOV2/Zdk1 dimer has previously been determined (Wang et al., 2016). (B) Overview of the one-step CRISPR/Cas9-mediated insertion of a π-element construct containing the photosensitive LOV2/Zdk1 module, a fluorescent protein marker, and an internal EF1α promoter. Arrows indicate the location of PCR primers. Lowercase letters indicate mutations introduced to make the homology-directed repair (HDR) template resistant to Cas9 cleavage. (C) Genomic PCR to validate π-element integration into the endogenous EB1 locus with primers as indicated in (B). The two clones shown

Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) i3N induced pluripotent stem cells Wang et al., 2017 Doxycycline- induced differentiation into cortical i3Neurons Cell line (Homo sapiens) NCI- H1299 ATCC CRL- 5803 Antibody anti- EB1 (N- terminal epitope, mouse monoclonal) Thermo Fisher Scientific Cat# 41–2100, RRID:AB_2533500 1:1000 (WB) Antibody anti- EB1 (C- terminal epitope, mouse monoclonal) BD Biosciences Cat# 610534, RRID:AB_397891 1:1000 (WB) Antibody anti- EB3 (rat monoclonal) Absea Cat# KT36 1:1000 (WB) Antibody anti- KIF2C (mouse monoclonal) Santa Cruz Biotechnology Cat# sc- 81305, RRID:AB_2132051 1:1000 (WB) Antibody anti- Oct- 3/4 (mouse monoclonal) Santa Cruz Biotechnology Cat# sc- 5279, RRID:AB_628051 1:500 (IF) Recombinant DNA reagent EB1N- LZ- LOV2 (plasmid) van Haren et al., 2018 Addgene plasmid 107614 Recombinant DNA reagent MSCV- PIG Scott Lowe, unpublished Addgene plasmid 18751 IRES plasmid Recombinant DNA reagent pmCherry- Zdk1- EB1C van Haren et al., 2018 Addgene plasmid 107695 Recombinant DNA reagent pSpCas9(BB)–2A- GFP Ran et al., 2013 Addgene plasmid 48138 Cas9 plasmid Sequence- based reagent EB1 Exon 1–2 Integrated DNA Technologies RT- qPCR primers, Hs.PT.58.1854993 Sequence- based reagent EB1 Exon 6–7 Integrated DNA Technologies RT- qPCR primers, Hs.PT.58.24290642 Sequence- based reagent EB3 Integrated DNA Technologies RT- qPCR primers, Hs.PT.58.20604386 Sequence- based reagent DCX Integrated DNA Technologies RT- qPCR primers, Hs.PT.58.118505 Dema et al. eLife 2023;12:e84143.

Techniques: Variant Assay, CRISPR, Construct, Marker, Clone Assay

Journal: eLife

Article Title: Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration

doi: 10.7554/eLife.57356

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , AGGAGCACACCAAAGGACCA , Eurofins , N/A , qPCR Met Exon 21 (reverse primer).

Techniques: In Situ, SYBR Green Assay, Sequencing

Journal: eLife

Article Title: Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration

doi: 10.7554/eLife.57356

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , GGCTGTATTCCCCTCCATCG , Eurofins , N/A , qPCR β-actin (reverse primer).

Techniques: In Situ, SYBR Green Assay, Sequencing

Journal: eLife

Article Title: Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration

doi: 10.7554/eLife.57356

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , CATTTTGGCTGTGTCTATCATG , Eurofins , N/A , qPCR Met (forward primer).

Techniques: In Situ, SYBR Green Assay, Sequencing

Journal: eLife

Article Title: Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration

doi: 10.7554/eLife.57356

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , CATTTTGGCTGTGTCTATCATG , Eurofins , N/A , qPCR Met Exon 17 (forward primer).

Techniques: In Situ, SYBR Green Assay, Sequencing

Journal: eLife

Article Title: Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration

doi: 10.7554/eLife.57356

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , CTTGCCAGAGACATGTACGAT , Eurofins , N/A , qPCR Met Exon 20 (forward primer).

Techniques: In Situ, SYBR Green Assay, Sequencing